September 20, 1894 (4 pages)

THE DAILY TRANSCRIPT Published Every Evoning, except Sunday, ABBOTT CONVICTED. The Jury Find Him Guilty of MurBROWN & CALKINS, Proprietors der in the Second Degree. After being out about twenty-four hours SERVED BY CARRIERS AT 15 Cts. per Week or 60 Cts. per Month the jury in the case of Ira W. Abbott rendered a verdict shortly after 11 o’clock this forenoon. It was generally believed, after WHEN PAID IN ADVANCE : _SIX DOLLARS FER YEAR. they had been out several hours, that there would be no agreement, The verdict is as follows: r ws We, the jury, find the defendant guilty. of THUR:DAY.,,. seesSEPT., 20, 1894, murder in the second degree, but the jury, . taking into consideration the unfortunate f ‘circumstances which caused the defendant Politi! Ancouncaments, to commit the deed, and in view of his youth and previous spotless character, we earnestly: recommend him to the mercy of Under no circumstances will any announcement be made until Paid for. $10 is the charge. the court, Gruman Wricut, Foreman. ,T. Dunkuey, Sec’y. When the jury retired the first: ballot For Treasurer. J. J. JACKSON Is the Regular nominee of the Peoples Party and solicits the votzs of the people of ail parties. stood five for murder in the firat degree, ene for manslaughter, three for acquittal, and one for murder in the second degreé. After that the ballots changed about considerably until midnight, when the jury stood ten fer murder in the second degree and two for manslaughter. At one time they stood seven for murder in the first degree, The For Superintendent of Schools. W. J. ROGERS Is the "Regular Republican nominee for Superintendent-of Schools. 6 For Disirict Attorney. E. B. POWER Is the Regular Republican nominee for District Attorney. For County Clerk. W. P. CALKINS Of Truckee is the regular nominee of the Republican Party for the office of County Clerk. For District Attorney. (. F. MOGLASHAN Of Truckee, is the regular nominee of thePopulist Party for District Attorney. Tans Pleasant Affair. . The bell souvenir social at, Armory Hall last evening was quite well attended and ‘was a very pleasant affair, Neat little venir pins, made of metal from the old ) bell that was destroyed when the Methodist Church was burned Jast April, were given to each ‘person. An interesting program of vucal and instrumental music and recitations was rendered. ee Centennial Gravel Mine. Chris. Myers has taken a contract to run 500 feet of tunnel at the Centennial. drift gravel mine. He went up to the mine today with other men and wil] begin work without delay, <A good supply of groceries, provisions, wood, etc., will he laid in, so that work can be continued without hindrance or delay on account of bad weather. When the centract is completed the com pany will determine as to what they will do in regard to working the property. . —_————-++-4@e-+>— Burned His Hand. Grass Valley Union: Supervisor Donnelly had an uncomfortable experience yesterday, While out inspecting some work just performed he lit his pipe-and a spark fell on his coat. . He did not notice it until .a hole had been burned through the garment and also his vest. In putting out the blaze his hand was bucned somewhat, % +-0@e->— es Deafness Cannot Be Cured “By local applications, as they cannot reach the diseased portion of the ear, There is only one way to cure Deafness, and that -is by constitutional remedies. Deafness is caused by an inflamed condition of the mucous lining of the Eustachian Tube. When this tube gets inflamed you have a wumbling sound or imperfect hearing, and when it is entirely closed Deafness is the result, and unless the inflammation can be taken out and this tube restored to its _ normal condition, hearing will be destroyed forever ; nine case out of ten are caused by eatarrh, which is nothing but an inflamed condition uf the mucous surfaces, We will give One Hundred Dollars for any case of Deafness (caused by catarrh) tha: cannot be cured by Hall’s Catarrh Cure. Send for circulars, free. F. J, CHENEY & CO,, Toledo, 0. &# Sold by Druggists, 75c. i Gitano tuckien’s Arnica Salve. The best Salve in the world for Cuts, Bruises, Sores, Ulcers, Salt Rheum, Fever Sores, Tetter, Chapped Hands, Chilblains, Corns, and all Skin Eruptions, and positively cures Piles, or no pay required. It is guaranteed to give perfect satisfacion o: money For refunded, Price 25 cents per box. sale at Carr Brothers’ Drug Store. two jurors who voted for manslaughter were Thomas Dunkley and Gilman Wright, of Grass Valley. They gave as a reason for their votes that they believed the defendant insane. They -were the only two jurors who were personally acquainted with the defendant, Some years ago Abbott worked for Dunkley’s son in -Grass Valley, and Wright was a partner of Dunkley. Two of the jurors stated that they did not at first favor the recommendation for mercy, but consented it to conciliate Dunkley and Wright. . While the verdict was being read, Abbott maintained his usually placid manner, not appearing nervous, and after it had been announced there was no perosptible change in his countenance. Monday next at 10 o’clock in the morning has been fixed as the time for passing sentence. RICH PROSPECT. oe Quartz That Assays Over $4,509 Per Ton. Henry Trevaskis, who resides at Indian Flat, near the schoolhouse, has for some time past been running a tunnel into Red Hill for the purpose of striking a quartz] ledge. After running 200 feet and not finding anything, he quit the tunnel and began sinking a shaft, about twenty feet he struck a smal] vein of decomposed quartz, of a reddish color, very rich quartz, Trevaskis has been pounding up this rich rock in a hand mortar and in this way has made good wages. The other part of the ledge matter he threw to one side, not considering it worth working. ~ The other day George B. TreadweH, the well-known mining expert, stopped at Trevaskis’ mine to see what prospects the former was meeting with. He noticéd the red rock that Trevaskis had thrown away, and upon looking at it carefully gave it as his opinion that it would be a good idea te have it worked, Trevaskis, however, did not agree with him. The quartz contains considerable oxide of iron. Mr, Treadwell took a sample of the poorest of this quartz and sent it to hisson in Amador county to be assayed. This. morning.he received a letter containing the result of the test, and also the gold button. The rock assayed $4,574.10 aton. Were it not for the pockety nature of that-section, moneyed companies would quickly take hold of this prospect. As he is working it Trevaskis is doing very well, and may devevelop a rich and permanent mine. « -Salmen for Everybody. : at A. B, Wolf’s Cash Grocery,’ Main street. PERSONAL POINTERS. A Concise Chronicle of Various Folks Doings and Intentions. H,. B. Catton of Sacramepto is in town. A. D. Gassaway and family came down from Forest City last evening. C. Hooper came down from Forest City yesterday. John Cook came down from Washington today. John McCarty of Washington was in town yesterday. F. McComb-came down from Red Dog today. Mrs, McInerney of Lake City is here on a visit to friends. Mrs. J. Martin and Miss M. Tierney came down from Bloomfield yesterday. E. Finane came down from Forest Hill today. Miss Annie Van Tardon of San Jose and Miss Annie Wehe, who have been to Dow nieville on @ visit to relatives, arrived here last evening on their way home. Chas. Helman and his daughter, Miss Harriet, of Oakland, arrived here last evenFine solid Salmon at 74 cents per pound, i IT 16 A LITTLE. EARLY To Adopt Tactics Which Can Be Exploded, if That Is the Game, ‘The Grass Valley Union takes exceptions to a truthful item that the Transcript published in relation to Bucknam’s candidacy forthe Assembly. That paper says the statement is a *‘sample of the tactics to elect Dan Burns’ Republican candidate for the Assembly,” Such a reply from the Union we regard as-very low politics. The editor of that paper knew that he was uttering a libel upon Hon. R. {. Thomas when he wrote the above statement, and in justice to that gentleman the Union should make the amende honorable. It is just a little too early to engage in that kind of politics, as there is plenty of time for contradiction and reaction, The statement made by thia paper in relation to Mr. Bucknam’s candidacy is known to be personally true by the editor of the Union, and he, nor ‘no other man of honor that was present in that convention, can gainsay it. . The Transcript julie aaa =“ truthful politics during this campaign, and will insist upon it. There is nothing to be ésinsa in faleitying a candidate simply because he belongs to another party. The ‘TRANSCRIPT is ever ready to do equal and exact justice to a Republican, Democrat or Populist, and hopes for the honor of journalism in this county, that the Union will join hands with it. ny WHATEVER may be the cause of blanching, the hair-may be restored to its original color by the use of that potent remedy Hall's Vegetable Sicilian Hair Renewer. sehen Tomorrow Night’s Play. The play ‘‘American Born’ to be presented at the Theatre tomorrow night will be mteresting from the rise of the curtain to the point where the villain is foiled in the last act. The cast, which embraces the best of local talent, is a strong one and all those who attend will be sure to enjoy it. At one time during the rendition of the play about thirty people will be on the stage. Tonight the players will have a dress rehearsal which will be the last one they will have until the evening of the performance. ‘The seats are selling rapidly and they will no doubt be greeted with a large house. ; —_ a mee WHEN your food has no relish, the stomach needs to be cleansed and strengthened by a . After getting down . dose or two of Ayer’s Pills, oe PERsons who lead a life of exposure are through which there was a narrow streak of} subject to rheumatism, neuralgia and lumbago and will find a valuable remedy in Dr. J. H, MecLean’s Volcanic Oil Liniment; it will banish pain and subdue inflammation, Sold at Carr Bros.’ Drug Store, Literary Note. Charles A. Dana, editor of the New York Sun, will be the subject of a very cimprehensive and interesting biographical study, by E. P. Mitchell; Mr. Dana's chief associate on The Sun, in Me( lure’s Magazine for October. The story of Mr. Dana’s' connection with Brook Farm, and of bis service during the. war‘as Assistant Secretary of War under Lincoln and Stanton, will be told with especial fullness, Views: of his office at The Sun and of his country home on Long Island, and a very interesting series of portraits of him, will accompany the article. —+-2@e > Board of Supervisors. ~ regular session on Monday next. All persons having bills against the county are requested to file them on or before Satur. day of this week. oe Advertised Letters. The following is a list of the letters remaining in the postoffice at Nevada City, Nevada County, Cal., September 20, 1894: Andrews, T. P. Angilley, Mrs, Barron, Edward Bently, David Bonpel!, Dr. John Pellow, Jas, Dell, E. G. Fuller, Geo, Hamilton, E, L Hamilton, Dock Harris, Jack Knox, George Maskef, Miss Annie Oliver, Mrs. Vena Podesta, og B. Rowe, Chas. W Ross, Charles i. Robinson, M. Shilling, W. B. Sledge, W. N. Strauss, Christine Tobeas, Dave Whittaker, Chas. Whittaker, Nettie Williams, Mrs, May N. ties calling for any of these letters will please say advertised, and pay a fee of one cent for each letter. The Board of Supervisors will meet in “If not called for in fifteen days the letters M. B. APPOINTMENTS. Where Some of the Well-Known Preachers Will Go This Year. The following appointments have been made by the Methodist Conference: Round Valley Indian Mission—Rev. Colin Anderson. Santa Rosa—Rev. Wm. Angwin. Atlanta—Rev. J. T. Curnow, Brentwood—Rev. Geo. Clifford. San Leandro—Rev. W. R. Gober. Stockton—Rev. J. W. Ross. Grass Valley—Rev. J. P. Macauley. Nevada City—Rev. J. T. Murriah. North San Juan—Rev. H: B. Sheldon. Richland—Rev, J. E. Wickes. Halfmoon District—Rev. Chas, E. Rich. Pacific Grove—Rev. W. 8S. Urmy. San Jose—Rev. W. B. Priddy. Santa Clara— Rev. A. H. Needham. Moral Instructor at Folsom—Rev. John Chisholm, Rev. A. T. Needham, presiding elder for Sacramento District. Rev, John Coyle, presiding elder for the San Francisco District. SSA err oretee™ «WHATEVER may be the cause of blanching, the hair may be restored to its original color-by the use of that potent remedy Hall’s Vegetable Sicilian Hair Renewer. ARRIVALS AT THE ~~ Exchange, Broad Street. G. W. Lane, Sao Francisco, T, J. Robinson, Grass Valley, T. Le Duc, F. W. Cunningham, A. T. Smith, G, Wright, ~ Thos. Dunkley, A. Ducotey, F, T. Marker, Ted Schwartz, Pleasant Valley, G. W. Giffin, Truckee, A. Y. Brown, Indian Springs, G, A. Tyler, Graniteville J. A. Craig, Columbia Hill, F.Hoskins, Chicago Park, W. M. Crutcher, Reber, H. B. Catton, Sacramento, A. D, Gassaway & wife, Forest Cc ity, Clarence Hooper, . Miss Harriet Heiman, Osklaad, K. H. Langley, San Francisco, Ed, Wylie, Freestone, Miss Annie Wehe, San Francisco, Miss Van Tardon, San Francisco, L. E. Jordan, Sacramento, P, H. Maxwell, San Francisco, Pp. J. Farrell, Marysville, Miss R. Barnes, Grass Valley, Miss B. Barnes, “ Mrs,_Aubury, W. Aubury, sé ae ir) ARRIVALS AT -THE— Union Hotel, Main Street. John Silva Jr., Freeport, C. L, Spellenger, San Francisco, J. W. Arbogast, Mrs, J. Martin, Bloomfield, Miss-M. Finney, of W. D. Lewis al wife, Colfax, Mrs, Kindle, A, ©. Henry and wife, Lake City, . Mrs, Black, Mrs, Melnerney, G. W. Cunningham, Grass _Valley, P. F. Smith, Gilman W right, Thos. LeDue, A. DuCotey, Thos, Dunkley, John H: Pascoe, L!-W, Batcher, L, C. Duval, A. J. Ridge, F. B, Ridge, Sam Butler, L. Cavanaugh, es “AS Y> Brown, Indian Springs, G. A. Tyler, Graniteville, J. A. Craig, Columbia Hill, G. W. Giffen, Truckee, F, Haskins, Chicago Park, F. T. Bernard, “ F,. McComb, Red Dog, John McCarthy, Washington. 2 ~ee as e oe th “as a cai ee “ Rea Farru never grows weak by having to wait, Sufferers taking Hood’s Sarsaparilla the result will be satisfactory. Hvod’s Cures Hoop’s Pitts act easily, yet promptly atid efficiently, on the liver and bowels. 25c. ~ Wanted. Any one having a copy of the Dai'y Transcrirr of July, 26th, 1894, will confer a great favor by sending it to this office. Piano Tuning. W. D, Travers, the well-known piano tuner, will be in Nevada City in a few days. {23 — im ———27ee Now’s Your Chance. Lawns and Challies for 5 cents per yard, at Mrs. Lester & Crawford's. Call and see them, atti _} on account:of its personal character, . purify your blood with Ayer’s Sarsaparilla, . . balls?” Has the reader, whose attention we . for chronic complaints should be patient and . NO USE FOR HIM. A Man That. Nevada County Can Afford to Spare. The particulars of the.action of the Grass Valley Miners’ Union yesterday in ordering Superintendent Schnabel of the Osborne Hill mine to leave town, have been already published by the Transcript. In carrying out their resolution the miners coriducted themselves in a very peaceable, quiet manner, but they were fully determined that the obnoxious and overbearing Superintendent should leave. While Mr. Schnabel may not be responsible for all ‘the grievances suffered by the men employed at the mine named, there is no question but what he is directly to blame for and was the instigator of many of the unjust regulations enforced upon employes. No man would attempt to enforce such rules as were ‘laid down by the Osborne Hill Company unless he was in. sympathy with such a movement, and public sentiment upholds the action taken by the miners in ordering him _to leave town, Aside from the very unfair and displeasing conditions to which the employes had to dubmit in order to keep their jobs, it is said that Schnabel was personally very dis— agreeable to the men and delighted in showing his authority. It was time that some resentment should be made and the miners rightly took it upon themselves to penee that urgent duty. Schnabel came down from his high perch very suddenly when confronted by the men, and wisely conchided that it would be best to obey their demand. He says he will endeavor to have the company adopt new rules and operate their property in a manner more satisfactory to the miners and the people generally. If he succeeds"he says he will return to take charge of the mine. It is our opinion that Schnabel has had his day in Grass Valley and that the town can get along without him or any others of his stamp. —— + e@e > Heap Good. We have received a conundrum from an anonymous correspondent, Although it is ‘‘away up’ we must decline publishing it It is surely very scathing on the late’ Democratic County-Convention, tte To enjoy sound and vigorous health, ———e eS es Fhe Fondest Hour Memory Reeahs: The question naturally suggests itself, Which is ‘‘the fondest hour memory: rehope to engage, ever had a controversy with his stomach on the subject of dyspepsia. After convincing proofs that the digsstive organ has got the upper hand, has a wise resort been made to Hostetter’s Stomach Bitters? If so, the “fondest hour” has been recalled by memory in the shape of a lasting resumption of the power to digest, assimilate thorcughly and eat heartily without fear of being uncomfortable afterward. When The Lowest Prices. Most wholesa'e firms employ drummers to travel for them and_ solicit trade. The salary of a good drummer is no small item of expense and of course has to be paid out of the profits of the business, which, in plainer terms, means that customers not only pay for the goods but for the drummer also, A. Isoard & Son of this city, wholesale, liquor merchants, employ no traveling agent and have no store rent to pay. These advantages enable them to sell goods at the very lowest’ prices, and saloon keepers and others can buy from them, in quantities to suit, cheaper than from San Francisco firms. ‘The prices of al! kinds of wines and liquors have been greatly reduce, Will Erect 4 On Brick Building. 4-0 e Rubert Simmons, w who yesterday purchased of Frank Aumer the salvon building on Pine street next door to the Masonic building, will take possession as soon as the present tenant, James McIntosh, oan find another place. Mr, Simmo.is says that—he will next spring or summer og down the old wooden structure and pfit up a good ‘brick building. It is quite likely that in that event the Masonic Hall Association will tear down the old building occupied by Mrs. Perry's restaurant and ‘erect in its place one of brick. They have for years contemplated making such an improvement, but did not want to do so unless the building below was of brick. WHEN persons are weak and languid, from sickness or overwork, feel debilitated and depressed, it is an indication that the blood is out of order, and they need help to throw off the miserable. feeling. The best remedy for this purpose is Dr, J. H, MeLean’s Strengthening Cordial and Blovd Puritier, It restores lost strength, gives vigor to circulation, promotes good appetite and a-flow of cheerful spirits, Price $1.00 per bottle, ene a ae Left For Germany. F; © Lu tj, durng hie recent visit to Germany, met some relatives of, Veter Shingle, the well-known old prospector who for many years has resided at Scott's flat. Shingle’s folks are wealthy people and they urged Mr, Luetje to try to induce Peter to return to Germ iny and live with them. He! — finally concluded todo so and left yesterday . for his native land, He sold his mine at Scott’s Flat a short time since .to M. Hucwey of Willew Valley, ~ ~ Pipe for Sain. 200 feet of 11Anquire of R. J, Simmons. oc. oe Two Lives Saved, ~ 1800 feet of 7-inch pipe. inch pipe. Mrs, Phoebe Thomas, of Junction City, Ill., was told by her doctors she had Consumption and that there was ho hope for her, but two bottles Dr. King’s New Diacovery completely cured her and she saya it saved her life. Mr, Thos, Eggers, 139 Florida St. San -Franciaco, suffered from a the dinner bell, that ‘‘tocsin of the soul,” strikes agreeably upon the ear, the auditor greets it as a welcome sound and ‘hastens to obey its summons. The Bitters, so renowned as a stomachic, overcome, too, malarial, billious and kidney trouble, and remedy nervousness, rheumatism and sick headache. = wOOD’S Sarsaparilla is carefully prepared by experienced pharmacists from Sarsaparilla, Dandelion, Mandrake, Dock, Pipsissewa, Juniper Berries, and other well known vegetdble remedies, ‘The Combination, Proportion and Process are Peculiar to Hood's, giving it curative power Peculiar to Itself. Hood's arsaparilla Cures Scrofula, Salt Rheum, Sores, Boils, Pimples and all other affections caused by impure blood; Dyspepsia, Biliousness, Sick Headache, Debility, Catarrh, Rheumatism, Kidney and Liver Complaints. It is Not What We Bay, but what Hood Sarsaparilla Bees, that Tells the Story— Hood's Sarsaparilla URES Hood’s Pilig win new friends daily. Who Will Win We offer an ELEGANT will be sent to the dead letter office. Par-. ~ Knives, Forks and Spoons To the person who guesses nearest to SILVER SET. OF IFOLEY, Opp. L. Hyman & Co.'s ee. 13 Sianoccial St., Sade City. eeneemememes esate att Ne dreadful cold, approaching Consumption, bought one bottle of Dr. King’s New Discovery and in two weeks was cured, He is naturally thankful. It is such ‘results, of which these are samples, that prove the wonderful efficacy of this medicine in Coughs and Colds, Free trial bottles at Carr Bros. aang Store. Regular size 50c. and $1.00, RTS SE TE a Rare Stonés. Leutje & Brand have jwat received'a large and elegant assortment of precious — stones, “verything bought at this old establishment guaranteed as represented, tf 2 2@e eo Sewing Machine Needies, Wheeler & Wilson needles for Nos. 6, 7, tried without result everything elue then {Exhibition Drill, Sand 7 wachines; at CURIE & BRAND Ss, ~[~ Electric Bitters. This remedy is becoming so well known =e 80 popular as to need no special men~ tion. : All who have used Electric Bitters ing the same song of praise.—A purerr medicine does not exist and it is guaranteed to do all that is claimed, Electric Bitters will cure all diseases of the Liver and Kidneys, will remove Pimples, Boils, Salt Rheum and other affections caused by‘ impure blood.— Will drive Malaria from the system. and prevent as well as cure all Malarial. fevers. For cure of Headache, Constipation and Indigestion try Electric Bitters. —Entire sati:faction guaranteed, or money refunded,—Price ’h0cts. and $1.00 per bottle at Carr Bros Drug Store, Absolutely Pure.j Acream of tartar baking powder. — Highest of all in leavening strength.—Latest United. States Government Foo Report. Royal Baking Powder (o., 106 Wall St. ‘Ni. Y, NEVADA THEATER, Friday Evening, September 21, 1894, The Sensational aud Patriotic Military and lining Drama, 4 i American Born a a oe oc 2 2 ek ee Under the auspices of COMPANY ‘“C,” 2d Inf. Regt.,.N. dG. C,, Directed by MER. G ROKRGE ALLEN WATSON, Assisted by Leonard 8. Calkins William A,-Ashburn George A, Barton Uharles K, Ashburn Mrs, Geo. A. Watson Emmett Costello Miss Mary Hook And Members of Ca, 8 O," Elmer , Black Theodore Jacobs R, P. Bowerman 2, : Prologue— Marking the Prey. Act 1—showing the Fangs. Act 2—Saved by the Stars and Stripes. Act 4—Union Forever, Co. C"" Music By Goyne’s Orchestra. General Admisson, 35 Cts. _ Children 25. Cents. Berracger (99um< “Alter somethin onable waste of energ the-same thing. It may candy and passes on a pinch, as it were. thing that would equal them, A WILD GOOSE which as a matter of fact is directl In NEVADA CITY, i be added, however, that when +t of say “FOLEY,” you mean Confectionery of the highest quality and not something which is merely an apology for You can’t beat m Pacifte Coast, and it would require something very like a wild. goose chase to find any‘aa CHASE under your hand is a most unreasOley and Confectionery mean candies anywhere on the LEADING CANDYMAKER, TEDLGLALALALALALALALOLALALALALAOLOLOLL YOU LOOK SHABBY! EP Rescrved Scats at Mulloy’s, 50 Cts, the number of votes that the next Gover-nor of this S ate will receive on November 6, 1894 . also a Beautiful Silver Sugar Bowl and Spoons To the person guessing nearest to the number of votes that the losing candidate will receive. The contest is open to. every person purchasing goods at our store, no matter how small the amount. Any person is allowed to guess every time a purchase is made by them. Should two or more have the same guess, the person making the first guess will be entitled tw the prize. &@ Don’t Fail to See the Prizes in Our. Window. > . And also notice the aed Line of Dressy Hatseeeecece That are being shown by us. 4/THE OLD RELIABLE, esas St. Under the Masagement of M. M. BARUH. N.B. Mail Orders Careful e ; istri we, ioarane y ” _ Customers fesm outside districts have the ing on thefr way to Bloomfield. Hon, ©, T, Jones, who has been engaged in the defense of Ira Abbott, returned to Sacramento last evening.Lzonarp 8. Canxina, P. M, Rca ea PO ei Dr. J, H. McLean's Strengthening Cordial and Blood Purifier is admirably adapted to make ‘‘a little health go a long way.” Its curative power is largely attributable to its stimulant, tonic and nutritive properties, by whieh the energy of the system is recruited. It is pleasant to the taste, easily borne on the stomach and harmless under prolonged use. Try it. : Sold at Carr Bros,, Drug Store. Lost. Between Sugar Loaf mountain and Union Hotel, a silver hat pin bearing initials J. A.C. Leave at Union Hotel’ and receive reward, 10% Auction Sale of Household Perniture. A lot of househcld furniture will be at public anction at the residence of Ei. Ryan, on Water street, commencing at 2 o'clock, on Siturday afternoon, Sept, 22d, td C, Coun, Auctioner, . Pack away that Sunimer Suit, that it may do for next Summer, Buy a B%ga)])] Suit, and be in atyle now ; and next year too, © no more to look well all the year round, and wear sedsonable clothes. OO” We have the finest line of FALL AND WINTER GOODS Ever Shown In the County. Cheviots and Clay Worsteds aes In Biues and Blacks. Neat Mixtures in Cassimeres. : Fine Greys and Tweeds. The Very Latest for Business Wear. Our Lins of Trousering::Cannot Be Excelled Anywhere! @@" Our Prices are the very Lowest. R. T. MORRISON, Merchant Tailor. 35 Pine Street, Nevapa Crry, UUUAAAGAUAAAAAAAUUAAAAAAU GUA Awarded ’ Highest Honors—World’s Fair. _ Convicted of Battery. In the case of the People vs. Ges. Allen, which ocenpied Justice Carr’s court this morning, -the jury found the defendant guilty. Justice Carr will pass. sentence upon hith tomorrow morning at 10 o'clock, Some time ago Allen had some trouble with Jobn Vail and.struck him, fracturing his nose, The latter swore out a warrant charging Allen with battery, and this was the charge upon which he wag convicted, —_+ +> Not Seriously Hurt. ‘ Miss Miller of Sau Francisco, who was thrown from a cart yesterday, as »published in last evening’s Taanscnirr, is rest~ jing quite easily today, The young lady was very badly bruised through -the aceident, but no serious results are anticipated J from the injuries, MOST PERFECT MADE. A pure Grape Cream of Tartar Powder. Fee fom Ammonia, Alum or any other aduiterant. 40 YEARS. THE STANDARD,

THE DAILY TRANSCRIPT Published Every Evoning, except Sunday, ABBOTT CONVICTED. The Jury Find Him Guilty of MurBROWN & CALKINS, Proprietors der in the Second Degree. After being out about twenty-four hours SERVED BY CARRIERS AT 15 Cts. per Week or 60 Cts. per Month the jury in the case of Ira W. Abbott rendered a verdict shortly after 11 o’clock this forenoon. It was generally believed, after WHEN PAID IN ADVANCE : _SIX DOLLARS FER YEAR. they had been out several hours, that there would be no agreement, The verdict is as follows: r ws We, the jury, find the defendant guilty. of THUR:DAY.,,. seesSEPT., 20, 1894, murder in the second degree, but the jury, . taking into consideration the unfortunate f ‘circumstances which caused the defendant Politi! Ancouncaments, to commit the deed, and in view of his youth and previous spotless character, we earnestly: recommend him to the mercy of Under no circumstances will any announcement be made until Paid for. $10 is the charge. the court, Gruman Wricut, Foreman. ,T. Dunkuey, Sec’y. When the jury retired the first: ballot For Treasurer. J. J. JACKSON Is the Regular nominee of the Peoples Party and solicits the votzs of the people of ail parties. stood five for murder in the firat degree, ene for manslaughter, three for acquittal, and one for murder in the second degreé. After that the ballots changed about considerably until midnight, when the jury stood ten fer murder in the second degree and two for manslaughter. At one time they stood seven for murder in the first degree, The For Superintendent of Schools. W. J. ROGERS Is the "Regular Republican nominee for Superintendent-of Schools. 6 For Disirict Attorney. E. B. POWER Is the Regular Republican nominee for District Attorney. For County Clerk. W. P. CALKINS Of Truckee is the regular nominee of the Republican Party for the office of County Clerk. For District Attorney. (. F. MOGLASHAN Of Truckee, is the regular nominee of thePopulist Party for District Attorney. Tans Pleasant Affair. . The bell souvenir social at, Armory Hall last evening was quite well attended and ‘was a very pleasant affair, Neat little venir pins, made of metal from the old ) bell that was destroyed when the Methodist Church was burned Jast April, were given to each ‘person. An interesting program of vucal and instrumental music and recitations was rendered. ee Centennial Gravel Mine. Chris. Myers has taken a contract to run 500 feet of tunnel at the Centennial. drift gravel mine. He went up to the mine today with other men and wil] begin work without delay, <A good supply of groceries, provisions, wood, etc., will he laid in, so that work can be continued without hindrance or delay on account of bad weather. When the centract is completed the com pany will determine as to what they will do in regard to working the property. . —_————-++-4@e-+>— Burned His Hand. Grass Valley Union: Supervisor Donnelly had an uncomfortable experience yesterday, While out inspecting some work just performed he lit his pipe-and a spark fell on his coat. . He did not notice it until .a hole had been burned through the garment and also his vest. In putting out the blaze his hand was bucned somewhat, % +-0@e->— es Deafness Cannot Be Cured “By local applications, as they cannot reach the diseased portion of the ear, There is only one way to cure Deafness, and that -is by constitutional remedies. Deafness is caused by an inflamed condition of the mucous lining of the Eustachian Tube. When this tube gets inflamed you have a wumbling sound or imperfect hearing, and when it is entirely closed Deafness is the result, and unless the inflammation can be taken out and this tube restored to its _ normal condition, hearing will be destroyed forever ; nine case out of ten are caused by eatarrh, which is nothing but an inflamed condition uf the mucous surfaces, We will give One Hundred Dollars for any case of Deafness (caused by catarrh) tha: cannot be cured by Hall’s Catarrh Cure. Send for circulars, free. F. J, CHENEY & CO,, Toledo, 0. &# Sold by Druggists, 75c. i Gitano tuckien’s Arnica Salve. The best Salve in the world for Cuts, Bruises, Sores, Ulcers, Salt Rheum, Fever Sores, Tetter, Chapped Hands, Chilblains, Corns, and all Skin Eruptions, and positively cures Piles, or no pay required. It is guaranteed to give perfect satisfacion o: money For refunded, Price 25 cents per box. sale at Carr Brothers’ Drug Store. two jurors who voted for manslaughter were Thomas Dunkley and Gilman Wright, of Grass Valley. They gave as a reason for their votes that they believed the defendant insane. They -were the only two jurors who were personally acquainted with the defendant, Some years ago Abbott worked for Dunkley’s son in -Grass Valley, and Wright was a partner of Dunkley. Two of the jurors stated that they did not at first favor the recommendation for mercy, but consented it to conciliate Dunkley and Wright. . While the verdict was being read, Abbott maintained his usually placid manner, not appearing nervous, and after it had been announced there was no perosptible change in his countenance. Monday next at 10 o’clock in the morning has been fixed as the time for passing sentence. RICH PROSPECT. oe Quartz That Assays Over $4,509 Per Ton. Henry Trevaskis, who resides at Indian Flat, near the schoolhouse, has for some time past been running a tunnel into Red Hill for the purpose of striking a quartz] ledge. After running 200 feet and not finding anything, he quit the tunnel and began sinking a shaft, about twenty feet he struck a smal] vein of decomposed quartz, of a reddish color, very rich quartz, Trevaskis has been pounding up this rich rock in a hand mortar and in this way has made good wages. The other part of the ledge matter he threw to one side, not considering it worth working. ~ The other day George B. TreadweH, the well-known mining expert, stopped at Trevaskis’ mine to see what prospects the former was meeting with. He noticéd the red rock that Trevaskis had thrown away, and upon looking at it carefully gave it as his opinion that it would be a good idea te have it worked, Trevaskis, however, did not agree with him. The quartz contains considerable oxide of iron. Mr, Treadwell took a sample of the poorest of this quartz and sent it to hisson in Amador county to be assayed.. This. morning.he received a letter containing the result of the test, and also the gold button. The rock assayed $4,574.10 aton. Were it not for the pockety nature of that-section, moneyed companies would quickly take hold of this prospect. As he is working it Trevaskis is doing very well, and may devevelop a rich and permanent mine. « -Salmen for Everybody. : at A. B, Wolf’s Cash Grocery,’ Main street. PERSONAL POINTERS. A Concise Chronicle of Various Folks Doings and Intentions. H,. B. Catton of Sacramepto is in town. A. D. Gassaway and family came down from Forest City last evening. C. Hooper came down from Forest City yesterday. John Cook came down from Washington today. John McCarty of Washington was in town yesterday. F. McComb-came down from Red Dog today. Mrs, McInerney of Lake City is here on a visit to friends. Mrs. J. Martin and Miss M. Tierney came down from Bloomfield yesterday. E. Finane came down from Forest Hill today. Miss Annie Van Tardon of San Jose and Miss Annie Wehe, who have been to Dow nieville on @ visit to relatives, arrived here last evening on their way home. Chas. Helman and his daughter, Miss Harriet, of Oakland, arrived here last evenFine solid Salmon at 74 cents per pound, i IT 16 A LITTLE. EARLY To Adopt Tactics Which Can Be Exploded, if That Is the Game, ‘The Grass Valley Union takes exceptions to a truthful item that the Transcript published in relation to Bucknam’s candidacy forthe Assembly. That paper says the statement is a *‘sample of the tactics to elect Dan Burns’ Republican candidate for the Assembly,” Such a reply from the Union we regard as-very low politics. The editor of that paper knew that he was uttering a libel upon Hon. R. {. Thomas when he wrote the above statement, and in justice to that gentleman the Union should make the amende honorable. It is just a little too early to engage in that kind of politics, as there is plenty of time for contradiction and reaction, The statement made by thia paper in relation to Mr. Bucknam’s candidacy is known to be personally true by the editor of the Union, and he, nor ‘no other man of honor that was present in that convention, can gainsay it. . The Transcript julie aaa =“ truthful politics during this campaign, and will insist upon it. There is nothing to be ésinsa in faleitying a candidate simply because he belongs to another party. The ‘TRANSCRIPT is ever ready to do equal and exact justice to a Republican, Democrat or Populist, and hopes for the honor of journalism in this county, that the Union will join hands with it. ny WHATEVER may be the cause of blanching, the hair-may be restored to its original color by the use of that potent remedy Hall's Vegetable Sicilian Hair Renewer. sehen Tomorrow Night’s Play. The play ‘‘American Born’ to be presented at the Theatre tomorrow night will be mteresting from the rise of the curtain to the point where the villain is foiled in the last act. The cast, which embraces the best of local talent, is a strong one and all those who attend will be sure to enjoy it. At one time during the rendition of the play about thirty people will be on the stage. Tonight the players will have a dress rehearsal which will be the last one they will have until the evening of the performance. ‘The seats are selling rapidly and they will no doubt be greeted with a large house. ; —_ a mee WHEN your food has no relish, the stomach needs to be cleansed and strengthened by a . After getting down . dose or two of Ayer’s Pills, oe PERsons who lead a life of exposure are through which there was a narrow streak of} subject to rheumatism, neuralgia and lumbago and will find a valuable remedy in Dr. J. H, MecLean’s Volcanic Oil Liniment; it will banish pain and subdue inflammation, Sold at Carr Bros.’ Drug Store, Literary Note. Charles A. Dana, editor of the New York Sun, will be the subject of a very cimprehensive and interesting biographical study, by E. P. Mitchell; Mr. Dana's chief associate on The Sun, in Me( lure’s Magazine for October. The story of Mr. Dana’s' connection with Brook Farm, and of bis service during the. war‘as Assistant Secretary of War under Lincoln and Stanton, will be told with especial fullness, Views: of his office at The Sun and of his country home on Long Island, and a very interesting series of portraits of him, will accompany the article. —+-2@e > Board of Supervisors. ~ regular session on Monday next. All persons having bills against the county are requested to file them on or before Satur. day of this week. oe Advertised Letters. The following is a list of the letters remaining in the postoffice at Nevada City, Nevada County, Cal., September 20, 1894: Andrews, T. P. Angilley, Mrs, Barron, Edward Bently, David Bonpel!, Dr. John Pellow, Jas, Dell, E. G. Fuller, Geo, Hamilton, E, L Hamilton, Dock Harris, Jack Knox, George Maskef, Miss Annie Oliver, Mrs. Vena Podesta, og B. Rowe, Chas. W Ross, Charles i. Robinson, M. Shilling, W. B. Sledge, W. N. Strauss, Christine Tobeas, Dave Whittaker, Chas. Whittaker, Nettie Williams, Mrs, May N. ties calling for any of these letters will please say advertised, and pay a fee of one cent for each letter. The Board of Supervisors will meet in “If not called for in fifteen days the letters M. B. APPOINTMENTS. Where Some of the Well-Known Preachers Will Go This Year. The following appointments have been made by the Methodist Conference: Round Valley Indian Mission—Rev. Colin Anderson. Santa Rosa—Rev. Wm. Angwin. Atlanta—Rev. J. T. Curnow, Brentwood—Rev. Geo. Clifford. San Leandro—Rev. W. R. Gober. Stockton—Rev. J. W. Ross. Grass Valley—Rev. J. P. Macauley. Nevada City—Rev. J. T. Murriah. North San Juan—Rev. H: B. Sheldon. Richland—Rev, J. E. Wickes. Halfmoon District—Rev. Chas, E. Rich. Pacific Grove—Rev. W. 8S. Urmy. San Jose—Rev. W. B. Priddy. Santa Clara— Rev. A. H. Needham. Moral Instructor at Folsom—Rev. John Chisholm, Rev. A. T. Needham, presiding elder for Sacramento District. Rev, John Coyle, presiding elder for the San Francisco District. SSA err oretee™ «WHATEVER may be the cause of blanching, the hair may be restored to its original color-by the use of that potent remedy Hall’s Vegetable Sicilian Hair Renewer. ARRIVALS AT THE ~~ Exchange, Broad Street. G. W. Lane, Sao Francisco, T, J. Robinson, Grass Valley, T. Le Duc, F. W. Cunningham, A. T. Smith, G, Wright, ~ Thos. Dunkley, A. Ducotey, F, T. Marker, Ted Schwartz, Pleasant Valley, G. W. Giffin, Truckee, A. Y. Brown, Indian Springs, G, A. Tyler, Graniteville J. A. Craig, Columbia Hill, F.Hoskins, Chicago Park, W. M. Crutcher, Reber, H. B. Catton, Sacramento, A. D, Gassaway & wife, Forest Cc ity, Clarence Hooper, . Miss Harriet Heiman, Osklaad, K. H. Langley, San Francisco, Ed, Wylie, Freestone, Miss Annie Wehe, San Francisco, Miss Van Tardon, San Francisco, L. E. Jordan, Sacramento, P, H. Maxwell, San Francisco, Pp. J. Farrell, Marysville, Miss R. Barnes, Grass Valley, Miss B. Barnes, “ Mrs,_Aubury, W. Aubury, sé ae ir) ARRIVALS AT -THE— Union Hotel, Main Street. John Silva Jr., Freeport, C. L, Spellenger, San Francisco, J. W. Arbogast, Mrs, J. Martin, Bloomfield, Miss-M. Finney, of W. D. Lewis al wife, Colfax, Mrs, Kindle, A, ©. Henry and wife, Lake City, . Mrs, Black, Mrs, Melnerney,

G. W. Cunningham, Grass _Valley, P. F. Smith, Gilman W right, Thos. LeDue, A. DuCotey, Thos, Dunkley, John H: Pascoe, L!-W, Batcher, L, C. Duval, A. J. Ridge, F. B, Ridge, Sam Butler, L. Cavanaugh, es “AS Y> Brown, Indian Springs, G. A. Tyler, Graniteville, J. A. Craig, Columbia Hill, G. W. Giffen, Truckee, F, Haskins, Chicago Park, F. T. Bernard, “ F,. McComb, Red Dog, John McCarthy, Washington. 2 ~ee as e oe th “as a cai ee “ Rea Farru never grows weak by having to wait, Sufferers taking Hood’s Sarsaparilla the result will be satisfactory. Hvod’s Cures Hoop’s Pitts act easily, yet promptly atid efficiently, on the liver and bowels. 25c. ~ Wanted. Any one having a copy of the Dai'y Transcrirr of July, 26th, 1894, will confer a great favor by sending it to this office. Piano Tuning. W. D, Travers, the well-known piano tuner, will be in Nevada City in a few days. {23 — im ———27ee Now’s Your Chance. Lawns and Challies for 5 cents per yard, at Mrs. Lester & Crawford's. Call and see them, atti _} on account:of its personal character, . purify your blood with Ayer’s Sarsaparilla, . . balls?” Has the reader, whose attention we . for chronic complaints should be patient and . NO USE FOR HIM. A Man That. Nevada County Can Afford to Spare. The particulars of the.action of the Grass Valley Miners’ Union yesterday in ordering Superintendent Schnabel of the Osborne Hill mine to leave town, have been already published by the Transcript. In carrying out their resolution the miners coriducted themselves in a very peaceable, quiet manner, but they were fully determined that the obnoxious and overbearing Superintendent should leave. While Mr. Schnabel may not be responsible for all ‘the grievances suffered by the men employed at the mine named, there is no question but what he is directly to blame for and was the instigator of many of the unjust regulations enforced upon employes. No man would attempt to enforce such rules as were ‘laid down by the Osborne Hill Company unless he was in. sympathy with such a movement, and public sentiment upholds the action taken by the miners in ordering him _to leave town, Aside from the very unfair and displeasing conditions to which the employes had to dubmit in order to keep their jobs, it is said that Schnabel was personally very dis— agreeable to the men and delighted in showing his authority. It was time that some resentment should be made and the miners rightly took it upon themselves to penee that urgent duty. Schnabel came down from his high perch very suddenly when confronted by the men, and wisely conchided that it would be best to obey their demand. He says he will endeavor to have the company adopt new rules and operate their property in a manner more satisfactory to the miners and the people generally. If he succeeds"he says he will return to take charge of the mine. It is our opinion that Schnabel has had his day in Grass Valley and that the town can get along without him or any others of his stamp. —— + e@e > Heap Good. We have received a conundrum from an anonymous correspondent, Although it is ‘‘away up’ we must decline publishing it It is surely very scathing on the late’ Democratic County-Convention, tte To enjoy sound and vigorous health, ———e eS es Fhe Fondest Hour Memory Reeahs: The question naturally suggests itself, Which is ‘‘the fondest hour memory: rehope to engage, ever had a controversy with his stomach on the subject of dyspepsia. After convincing proofs that the digsstive organ has got the upper hand, has a wise resort been made to Hostetter’s Stomach Bitters? If so, the “fondest hour” has been recalled by memory in the shape of a lasting resumption of the power to digest, assimilate thorcughly and eat heartily without fear of being uncomfortable afterward. When The Lowest Prices. Most wholesa'e firms employ drummers to travel for them and_ solicit trade. The salary of a good drummer is no small item of expense and of course has to be paid out of the profits of the business, which, in plainer terms, means that customers not only pay for the goods but for the drummer also, A. Isoard & Son of this city, wholesale, liquor merchants, employ no traveling agent and have no store rent to pay. These advantages enable them to sell goods at the very lowest’ prices, and saloon keepers and others can buy from them, in quantities to suit, cheaper than from San Francisco firms. ‘The prices of al! kinds of wines and liquors have been greatly reduce, Will Erect 4 On Brick Building. 4-0 e Rubert Simmons, w who yesterday purchased of Frank Aumer the salvon building on Pine street next door to the Masonic building, will take possession as soon as the present tenant, James McIntosh, oan find another place. Mr, Simmo.is says that—he will next spring or summer og down the old wooden structure and pfit up a good ‘brick building. It is quite likely that in that event the Masonic Hall Association will tear down the old building occupied by Mrs. Perry's restaurant and ‘erect in its place one of brick. They have for years contemplated making such an improvement, but did not want to do so unless the building below was of brick. WHEN persons are weak and languid, from sickness or overwork, feel debilitated and depressed, it is an indication that the blood is out of order, and they need help to throw off the miserable. feeling. The best remedy for this purpose is Dr, J. H, MeLean’s Strengthening Cordial and Blovd Puritier, It restores lost strength, gives vigor to circulation, promotes good appetite and a-flow of cheerful spirits, Price $1.00 per bottle, ene a ae Left For Germany. F; © Lu tj, durng hie recent visit to Germany, met some relatives of, Veter Shingle, the well-known old prospector who for many years has resided at Scott's flat. Shingle’s folks are wealthy people and they urged Mr, Luetje to try to induce Peter to return to Germ iny and live with them. He! — finally concluded todo so and left yesterday . for his native land, He sold his mine at Scott’s Flat a short time since .to M. Hucwey of Willew Valley, ~ ~ Pipe for Sain. 200 feet of 11Anquire of R. J, Simmons. oc. oe Two Lives Saved, ~ 1800 feet of 7-inch pipe. inch pipe. Mrs, Phoebe Thomas, of Junction City, Ill., was told by her doctors she had Consumption and that there was ho hope for her, but two bottles Dr. King’s New Diacovery completely cured her and she saya it saved her life. Mr, Thos, Eggers, 139 Florida St. San -Franciaco, suffered from a the dinner bell, that ‘‘tocsin of the soul,” strikes agreeably upon the ear, the auditor greets it as a welcome sound and ‘hastens to obey its summons. The Bitters, so renowned as a stomachic, overcome, too, malarial, billious and kidney trouble, and remedy nervousness, rheumatism and sick headache. = wOOD’S Sarsaparilla is carefully prepared by experienced pharmacists from Sarsaparilla, Dandelion, Mandrake, Dock, Pipsissewa, Juniper Berries, and other well known vegetdble remedies, ‘The Combination, Proportion and Process are Peculiar to Hood's, giving it curative power Peculiar to Itself. Hood's arsaparilla Cures Scrofula, Salt Rheum, Sores, Boils, Pimples and all other affections caused by impure blood; Dyspepsia, Biliousness, Sick Headache, Debility, Catarrh, Rheumatism, Kidney and Liver Complaints. It is Not What We Bay, but what Hood Sarsaparilla Bees, that Tells the Story— Hood's Sarsaparilla URES Hood’s Pilig win new friends daily. Who Will Win We offer an ELEGANT will be sent to the dead letter office. Par-. ~ Knives, Forks and Spoons To the person who guesses nearest to SILVER SET. OF IFOLEY, Opp. L. Hyman & Co.'s ee. 13 Sianoccial St., Sade City. eeneemememes esate att Ne dreadful cold, approaching Consumption, bought one bottle of Dr. King’s New Discovery and in two weeks was cured, He is naturally thankful. It is such ‘results, of which these are samples, that prove the wonderful efficacy of this medicine in Coughs and Colds, Free trial bottles at Carr Bros. aang Store. Regular size 50c. and $1.00, RTS SE TE a Rare Stonés. Leutje & Brand have jwat received'a large and elegant assortment of precious — stones, “verything bought at this old establishment guaranteed as represented, tf 2 2@e eo Sewing Machine Needies, Wheeler & Wilson needles for Nos. 6, 7, tried without result everything elue then {Exhibition Drill, Sand 7 wachines; at CURIE & BRAND Ss, ~[~ Electric Bitters. This remedy is becoming so well known =e 80 popular as to need no special men~ tion. : All who have used Electric Bitters ing the same song of praise.—A purerr medicine does not exist and it is guaranteed to do all that is claimed, Electric Bitters will cure all diseases of the Liver and Kidneys, will remove Pimples, Boils, Salt Rheum and other affections caused by‘ impure blood.— Will drive Malaria from the system. and prevent as well as cure all Malarial. fevers. For cure of Headache, Constipation and Indigestion try Electric Bitters. —Entire sati:faction guaranteed, or money refunded,—Price ’h0cts. and $1.00 per bottle at Carr Bros Drug Store, Absolutely Pure.j Acream of tartar baking powder. — Highest of all in leavening strength.—Latest United. States Government Foo Report. Royal Baking Powder (o., 106 Wall St. ‘Ni. Y, NEVADA THEATER, Friday Evening, September 21, 1894, The Sensational aud Patriotic Military and lining Drama, 4 i American Born a a oe oc 2 2 ek ee Under the auspices of COMPANY ‘“C,” 2d Inf. Regt.,.N. dG. C,, Directed by MER. G ROKRGE ALLEN WATSON, Assisted by Leonard 8. Calkins William A,-Ashburn George A, Barton Uharles K, Ashburn Mrs, Geo. A. Watson Emmett Costello Miss Mary Hook And Members of Ca, 8 O," Elmer , Black Theodore Jacobs R, P. Bowerman 2, : Prologue— Marking the Prey. Act 1—showing the Fangs. Act 2—Saved by the Stars and Stripes. Act 4—Union Forever, Co. C"" Music By Goyne’s Orchestra. General Admisson, 35 Cts. _ Children 25. Cents. Berracger (99um< “Alter somethin onable waste of energ the-same thing. It may candy and passes on a pinch, as it were. thing that would equal them, A WILD GOOSE which as a matter of fact is directl In NEVADA CITY, i be added, however, that when +t of say “FOLEY,” you mean Confectionery of the highest quality and not something which is merely an apology for You can’t beat m Pacifte Coast, and it would require something very like a wild. goose chase to find any‘aa CHASE under your hand is a most unreasOley and Confectionery mean candies anywhere on the LEADING CANDYMAKER, TEDLGLALALALALALALALOLALALALALAOLOLOLL YOU LOOK SHABBY! EP Rescrved Scats at Mulloy’s, 50 Cts, the number of votes that the next Gover-nor of this S ate will receive on November 6, 1894 . also a Beautiful Silver Sugar Bowl and Spoons To the person guessing nearest to the number of votes that the losing candidate will receive. The contest is open to. every person purchasing goods at our store, no matter how small the amount. Any person is allowed to guess every time a purchase is made by them. Should two or more have the same guess, the person making the first guess will be entitled tw the prize. &@ Don’t Fail to See the Prizes in Our. Window. > . And also notice the aed Line of Dressy Hatseeeecece That are being shown by us. 4/THE OLD RELIABLE, esas St. Under the Masagement of M. M. BARUH. N.B. Mail Orders Careful e ; istri we, ioarane y ” _ Customers fesm outside districts have the ing on thefr way to Bloomfield. Hon, ©, T, Jones, who has been engaged in the defense of Ira Abbott, returned to Sacramento last evening.Lzonarp 8. Canxina, P. M, Rca ea PO ei Dr. J, H. McLean's Strengthening Cordial and Blood Purifier is admirably adapted to make ‘‘a little health go a long way.” Its curative power is largely attributable to its stimulant, tonic and nutritive properties, by whieh the energy of the system is recruited. It is pleasant to the taste, easily borne on the stomach and harmless under prolonged use. Try it. : Sold at Carr Bros,, Drug Store. Lost. Between Sugar Loaf mountain and Union Hotel, a silver hat pin bearing initials J. A.C. Leave at Union Hotel’ and receive reward, 10% Auction Sale of Household Perniture. A lot of househcld furniture will be at public anction at the residence of Ei. Ryan, on Water street, commencing at 2 o'clock, on Siturday afternoon, Sept, 22d, td C, Coun, Auctioner, . Pack away that Sunimer Suit, that it may do for next Summer, Buy a B%ga)])] Suit, and be in atyle now ; and next year too, © no more to look well all the year round, and wear sedsonable clothes. OO” We have the finest line of FALL AND WINTER GOODS Ever Shown In the County. Cheviots and Clay Worsteds aes In Biues and Blacks. Neat Mixtures in Cassimeres. : Fine Greys and Tweeds. The Very Latest for Business Wear. Our Lins of Trousering::Cannot Be Excelled Anywhere! @@" Our Prices are the very Lowest. R. T. MORRISON, Merchant Tailor. 35 Pine Street, Nevapa Crry, UUUAAAGAUAAAAAAAUUAAAAAAU GUA Awarded ’ Highest Honors—World’s Fair. _ Convicted of Battery. In the case of the People vs. Ges. Allen, which ocenpied Justice Carr’s court this morning, -the jury found the defendant guilty. Justice Carr will pass. sentence upon hith tomorrow morning at 10 o'clock, Some time ago Allen had some trouble with Jobn Vail and.struck him, fracturing his nose, The latter swore out a warrant charging Allen with battery, and this was the charge upon which he wag convicted, —_+ +> Not Seriously Hurt. ‘ Miss Miller of Sau Francisco, who was thrown from a cart yesterday, as »published in last evening’s Taanscnirr, is rest~ jing quite easily today, The young lady was very badly bruised through -the aceident, but no serious results are anticipated J from the injuries, MOST PERFECT MADE. A pure Grape Cream of Tartar Powder. Fee fom Ammonia, Alum or any other aduiterant. 40 YEARS. THE STANDARD,